Mature sequence osa-miR159c

Accession numberMIMAT0001024
IDosa-miR159c
Stem-Loop osa-MIR159c
Sequence
auuggauugaagggagcucca
Get sequence
Deep sequencing1755 reads, 2 experiments
Database links
QuickGO function

References

1