Mature sequence osa-miR171h

Accession numberMIMAT0001077
IDosa-miR171h
Stem-Loop osa-MIR171h
Sequence
gugagccgaaccaauaucacu
Get sequence
Deep sequencing16 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:15258262 "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis" Sunkar R, Zhu JK Plant Cell. 16:2001-2019(2004).