Mature sequence osa-miR408-3p

Accession numberMIMAT0001079
IDosa-miR408-3p
Previous IDsosa-miR408
Stem-Loop osa-MIR408
Sequence
cugcacugccucuucccuggc
Get sequence
Deep sequencing40 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:15258262 "Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis" Sunkar R, Zhu JK Plant Cell. 16:2001-2019(2004).
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).