Mature sequence gga-miR-205b

Accession numberMIMAT0001164
IDgga-miR-205b
Stem-Loop gga-mir-205b
Sequence
cccuucauuccaccggaaucug
Get sequence
Deep sequencing114 reads, 5 experiments
Predicted targets

References

1
" McBride D, Carre W, Law A, Clinton M Unpublished.
2
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).