Mature sequence cbr-miR-356

Accession numberMIMAT0001294
IDcbr-miR-356
Stem-Loop cbr-mir-356
Sequence
augagcaacgcgaacaaaucc
Get sequence
Deep sequencing reads, experiments

References

1