Mature sequence oar-miR-431

Accession numberMIMAT0001414
IDoar-miR-431
Stem-Loop oar-mir-431
Sequence
ugucuugcaggccgucaugcagg
Get sequence
Deep sequencing87 reads, 12 experiments

References

1
PMID:15854907 "RNAi-mediated allelic trans-interaction at the imprinted Rtl1/Peg11 locus" Davis E, Caiment F, Tordoir X, Cavaille J, Ferguson-Smith A, Cockett N, Georges M, Charlier C Curr Biol. 15:743-749(2005).