Mature sequence oar-miR-127

Accession numberMIMAT0001415
IDoar-miR-127
Stem-Loop oar-mir-127
Sequence
aucggauccgucugagcuuggcu
Get sequence
Deep sequencing4428 reads, 13 experiments

References

1
PMID:15854907 "RNAi-mediated allelic trans-interaction at the imprinted Rtl1/Peg11 locus" Davis E, Caiment F, Tordoir X, Cavaille J, Ferguson-Smith A, Cockett N, Georges M, Charlier C Curr Biol. 15:743-749(2005).