Mature sequence aga-miR-282

Accession numberMIMAT0001514
IDaga-miR-282
Stem-Loop aga-mir-282
Sequence
aaucuagccucuucuaggcuuugucugu
Get sequence
Deep sequencing reads, experiments

References