Mature sequence aga-miR-8

Accession numberMIMAT0001525
IDaga-miR-8
Stem-Loop aga-mir-8
Sequence
uaauacugucagguaaagauguc
Get sequence
Deep sequencing reads, experiments

References