Mature sequence osa-miR439e

Accession numberMIMAT0001593
IDosa-miR439e
Previous IDsosa-MIR439e
Stem-Loop osa-MIR439e
Sequence
ugucgaaccgcgguuguucga
Get sequence
Deep sequencing74 reads, 2 experiments
Database links
QuickGO function

References

1
PMID:15805478 "Cloning and characterization of microRNAs from rice" Sunkar R, Girke T, Jain PK, Zhu JK Plant Cell. 17:1397-1411(2005).