Mature sequence zma-miR169h

Accession numberMIMAT0001731
IDzma-miR169h
Stem-Loop zma-MIR169h
Sequence
uagccaaggaugacuugccua
Get sequence
Deep sequencing1509 reads, 136 experiments

References

1
"Conservation and divergence of microRNA families in plants" Dezulian T, Palatnik JF, Huson DH, Weigel D http://genomebiology.com/2005/6/11/p13 (2005).