Mature sequence dre-miR-19d-3p

Accession numberMIMAT0001785
IDdre-miR-19d-3p
Previous IDsdre-miR-19d
Stem-Loop dre-mir-19d
Sequence
ugugcaaacccaugcaaaacuga
Get sequence
Deep sequencing27618 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).