Mature sequence dre-miR-30c-5p

Accession numberMIMAT0001805
IDdre-miR-30c-5p
Previous IDsdre-miR-30c
Stem-Loop dre-mir-30c
Sequence
uguaaacauccuacacucucag
Get sequence
Deep sequencing24071 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).