Mature sequence dre-miR-141-3p

Accession numberMIMAT0001837
IDdre-miR-141-3p
Previous IDsdre-miR-141
Stem-Loop dre-mir-141
Sequence
uaacacugucugguaacgaugc
Get sequence
Deep sequencing71356 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).