Mature sequence dre-miR-301b-3p

Accession numberMIMAT0001871
IDdre-miR-301b-3p
Previous IDsdre-miR-301b
Stem-Loop dre-mir-301b
Sequence
cagugcaauaguauugucauug
Get sequence
Deep sequencing3163 reads, 10 experiments
Predicted targets

References

1
PMID:15937218 "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T Genes Dev. 19:1288-1293(2005).