Mature sequence ssc-miR-32

Accession numberMIMAT0002149
IDssc-miR-32
Stem-Loop ssc-mir-32
Sequence
uauugcacauuacuaaguugc
Get sequence
Deep sequencing1523 reads, 13 experiments

References

1
PMID:15885146 "Pigs in sequence space: a 0.66X coverage pig genome survey based on shotgun sequencing" Wernersson R, Schierup MH, Jorgensen FG, Gorodkin J, Panitz F, Staerfeldt HH, Christensen OF, Mailund T, Hornshoj H, Klein A, Wang J, Liu B, Hu S, Dong W, Li W, Wong GK, Yu J, Wang J, Bendixen C, Fredholm M, Brunak S, Yang H, Bolund L BMC Genomics. 6:70(2005).