Accession | MIMAT0003120 |
Description | mmu-miR-483-3p mature miRNA |
Hairpins | |
Sequence | UCACUCCUCCCCUCCCGUCUU |
Evidence |
experimental
cloned [1], Illumina [2-3] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22223106 | has_input UniProtKB:Q07104 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22223106 | has_input UniProtKB:Q07104 |
involved_in | GO:0045599 negative regulation of fat cell differentiation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22223106 |