Mature sequence rno-miR-483-3p

Accession numberMIMAT0003121
IDrno-miR-483-3p
Previous IDsrno-miR-483
Stem-Loop rno-mir-483
Sequence
cacuccuccccucccgucuugu
Get sequence
Deep sequencing3760 reads, 235 experiments
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).