Mature sequence hsa-miR-581

Accession numberMIMAT0003246
IDhsa-miR-581
Stem-Loop hsa-mir-581
Sequence
ucuuguguucucuagaucagu
Get sequence
Deep sequencing87 reads, 43 experiments
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).