Mature sequence gga-miR-202-5p

Accession numberMIMAT0003354
IDgga-miR-202-5p
Previous IDsgga-miR-202*
Stem-Loop gga-mir-202
Sequence
uuuccuaugcauauacuucuuu
Get sequence
Deep sequencing371 reads, 2 experiments
Predicted targets

References

1
" McBride D, Carre W, Law A, Clinton M Unpublished.