Mature sequence ebv-miR-BART14-3p

Accession numberMIMAT0003426
IDebv-miR-BART14-3p
Previous IDsebv-miR-BART14-3p;ebv-miR-BART14
Stem-Loop ebv-mir-BART14
Sequence
uaaaugcugcaguaguagggau
Get sequence
Deep sequencing reads, experiments

References

1
2
PMID:16557291 "Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed" Cai X, Schafer A, Lu S, Bilello JP, Desrosiers RC, Edwards R, Raab-Traub N, Cullen BR PLoS Pathog. 2:e23(2006).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).