Mature sequence ebv-miR-BART16

Accession numberMIMAT0003714
IDebv-miR-BART16
Stem-Loop ebv-mir-BART16
Sequence
uuagauagagugggugugugcucu
Get sequence
Deep sequencing reads, experiments

References

1
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).