Mature sequence dre-miR-722

Accession numberMIMAT0003748
IDdre-miR-722
Stem-Loop dre-mir-722
Sequence
uuuuuugcagaaacguuucagauu
Get sequence
Deep sequencing845 reads, 10 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).