Mature sequence dre-miR-731

Accession numberMIMAT0003761
IDdre-miR-731
Stem-Loop dre-mir-731
Sequence
aaugacacguuuucucccggaucg
Get sequence
Deep sequencing136645 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).