Mature sequence dre-miR-738

Accession numberMIMAT0003769
IDdre-miR-738
Stem-Loop dre-mir-738
Sequence
gcuacggcccgcgucgggaccuc
Get sequence
Deep sequencing2199 reads, 16 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).