Mature sequence osa-miR395o

Accession numberMIMAT0003872
IDosa-miR395o
Stem-Loop osa-MIR395o
Sequence
augaaguguuuggaggaacuc
Get sequence
Deep sequencing30 reads, 2 experiments

References

1
PMID:16117853 "Molecular evolution of the rice miR395 gene family" Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L Cell Res. 15:631-638(2005).