Mature sequence osa-miR395w

Accession numberMIMAT0003877
IDosa-miR395w
Stem-Loop osa-MIR395w
Sequence
gugaaguguuugggggauucuc
Get sequence
Deep sequencing23 reads, 2 experiments

References

1
PMID:16117853 "Molecular evolution of the rice miR395 gene family" Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L Cell Res. 15:631-638(2005).
2
PMID:20131478 "Cloning and validation of novel miRNA from basmati rice indicates cross talk between abiotic and biotic stresses" Sanan-Mishra N, Kumar V, Sopory SK, Mukherjee SK Mol Genet Genomics. 282:463-474(2009).