Mature sequence osa-miR810a

Accession numberMIMAT0004045
IDosa-miR810a
Previous IDsosa-miR810
Stem-Loop osa-MIR810a
Sequence
ucauaagcccaccacaugugg
Get sequence
Deep sequencing3 reads, 2 experiments
Database links
QuickGO function

References

1