Mature sequence osa-miR815c

Accession numberMIMAT0004060
IDosa-miR815c
Stem-Loop osa-MIR815c
Sequence
aaggggauugaggagauuggg
Get sequence
Deep sequencing1964 reads, 2 experiments
Database links
QuickGO function

References

1