Mature sequence mdo-miR-9a-5p

Accession numberMIMAT0004087
IDmdo-miR-9a-5p
Previous IDsmdo-miR-9
Stem-Loop mdo-mir-9a-2 mdo-mir-9a-1 mdo-mir-9a-3
Sequence
ucuuugguuaucuagcuguauga
Get sequence
Deep sequencing6991910 reads, 5 experiments
Database links
Predicted targets
QuickGO function

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).