Mature sequence mdo-miR-107

Accession numberMIMAT0004100
IDmdo-miR-107
Stem-Loop mdo-mir-107
Sequence
agcagcauuguacagggcuauca
Get sequence
Deep sequencing207512 reads, 5 experiments
Database links
Predicted targets
QuickGO function

References

1