Mature sequence mdo-miR-130a-3p

Accession numberMIMAT0004106
IDmdo-miR-130a-3p
Stem-Loop mdo-mir-130a
Sequence
cagugcaauguaaaaagggcau
Get sequence
Deep sequencing20167 reads, 5 experiments
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).