Mature sequence mdo-miR-208a

Accession numberMIMAT0004129
IDmdo-miR-208a
Stem-Loop mdo-mir-208a
Sequence
auaagacgagcaaaaagcucgu
Get sequence
Deep sequencing199 reads, 1 experiments
Predicted targets

References

1