Mature sequence mdo-miR-216

Accession numberMIMAT0004131
IDmdo-miR-216
Stem-Loop mdo-mir-216
Sequence
uaaucucagcuggcaacugug
Get sequence
Deep sequencing54 reads, 5 experiments
Predicted targets

References

1