Mature sequence mdo-miR-217

Accession numberMIMAT0004132
IDmdo-miR-217
Stem-Loop mdo-mir-217
Sequence
uacugcaucaggaacugauuggau
Get sequence
Deep sequencing26 reads, 4 experiments
Predicted targets

References

1