Mature sequence mdo-let-7b

Accession numberMIMAT0004162
IDmdo-let-7b
Stem-Loop mdo-let-7b
Sequence
ugagguaguagguugugugguu
Get sequence
Deep sequencing5680734 reads, 5 experiments
Database links
Predicted targets
QuickGO function

References

1