Mature sequence mdo-miR-302b

Accession numberMIMAT0004180
IDmdo-miR-302b
Stem-Loop mdo-mir-302b
Sequence
uaagugcuuccauguuuugg
Get sequence
Deep sequencing37 reads, 4 experiments
Predicted targets

References

1