Mature sequence mdo-miR-302c

Accession numberMIMAT0004181
IDmdo-miR-302c
Stem-Loop mdo-mir-302c
Sequence
uaagugcuuccauguuucagu
Get sequence
Deep sequencing17 reads, 3 experiments
Predicted targets

References

1