Mature mmu-miR-29b-1-5p
| Accession | MIMAT0004523 |
| Description | mmu-miR-29b-1-5p mature miRNA |
| Hairpins | |
| Sequence | GCUGGUUUCAUAUGGUGGUUUA |
| Evidence |
experimental
cloned [5], Illumina [6-7] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24236890 | has_input UniProtKB:Q60769 |
| involved_in | GO:0001819 positive regulation of cytokine production |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24236890 | |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24236890 | has_input UniProtKB:Q60769 |
| involved_in | GO:0051607 defense response to virus |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24236890 | |
| involved_in | GO:1900182 positive regulation of protein localization to nucleus |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24236890 | |
| involved_in | GO:1901224 positive regulation of non-canonical NF-kappaB signal transduction |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24236890 |
