Accession | MIMAT0004592 |
Description | hsa-miR-125b-1-3p mature miRNA |
Hairpins | |
Sequence | ACGGGUUAGGCUCUUGGGAGCU |
Evidence |
experimental
cloned [5] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28947385 | has_input UniProtKB:Q9C009 |
involved_in | GO:0001934 positive regulation of protein phosphorylation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28947385 | occurs_in CL:0000540 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28947385 | has_input UniProtKB:Q9C009 |
involved_in | GO:0043525 positive regulation of neuron apoptotic process |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28947385 | |
involved_in | GO:1902949 positive regulation of tau-protein kinase activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28947385 | occurs_in CL:0000540 |
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|