Accession | MIMAT0004601 |
Description | hsa-miR-145-3p mature miRNA |
Hairpins | |
Sequence | GGAUUCCUGGAAAUACUGUUCU |
Evidence |
experimental
cloned [4] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0032733 positive regulation of interleukin-10 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30634164 | |
acts_upstream_of | GO:0043032 positive regulation of macrophage activation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30634164 | |
acts_upstream_of | GO:0045651 positive regulation of macrophage differentiation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30634164 | results_in_development_of CL:0000890 |
acts_upstream_of | GO:0050728 negative regulation of inflammatory response |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30634164 | occurs_in CL:0000890 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30634164 | has_input UniProtKB:Q14005 |
involved_in | GO:0032699 negative regulation of interleukin-16 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30634164 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24065611 | has_input UniProtKB:Q9Y624 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30634164 | has_input UniProtKB:Q14005 |