Mature sequence ebv-miR-BART10-5p

Accession numberMIMAT0004817
IDebv-miR-BART10-5p
Previous IDsebv-miR-BART10*
Stem-Loop ebv-mir-BART10
Sequence
gccaccucuuugguucuguaca
Get sequence
Deep sequencing reads, experiments

References

1
2
PMID:16557291 "Epstein-Barr virus microRNAs are evolutionarily conserved and differentially expressed" Cai X, Schafer A, Lu S, Bilello JP, Desrosiers RC, Edwards R, Raab-Traub N, Cullen BR PLoS Pathog. 2:e23(2006).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).