Mature sequence mmu-miR-882

Accession numberMIMAT0004847
IDmmu-miR-882
Stem-Loop mmu-mir-882
Sequence
aggagagaguuagcgcauuagu
Get sequence
Deep sequencing2 reads, 2 experiments
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).