Mature sequence mmu-miR-466g

Accession numberMIMAT0004883
IDmmu-miR-466g
Stem-Loop mmu-mir-466g
Sequence
auacagacacaugcacacaca
Get sequence
Deep sequencing6675 reads, 96 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).