Mature sequence hsa-miR-300

Accession numberMIMAT0004903
IDhsa-miR-300
Stem-Loop hsa-mir-300
Sequence
uauacaagggcagacucucucu
Get sequence
Deep sequencing19 reads, 9 experiments
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).