Mature sequence hsa-miR-875-5p

Accession numberMIMAT0004922
IDhsa-miR-875-5p
Stem-Loop hsa-mir-875
Sequence
uauaccucaguuuuaucaggug
Get sequence
Deep sequencing9 reads, 7 experiments
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).