Mature sequence hsa-miR-935

Accession numberMIMAT0004978
IDhsa-miR-935
Stem-Loop hsa-mir-935
Sequence
ccaguuaccgcuuccgcuaccgc
Get sequence
Deep sequencing6467 reads, 103 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).