Mature sequence hsa-miR-936

Accession numberMIMAT0004979
IDhsa-miR-936
Stem-Loop hsa-mir-936
Sequence
acaguagagggaggaaucgcag
Get sequence
Deep sequencing10 reads, 8 experiments
Predicted targets

References

1
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).