Mature sequence hsa-miR-941

• Accession number: MIMAT0004984
• ID: hsa-miR-941
• Stem-Loop: hsa-mir-941-1 hsa-mir-941-2 hsa-mir-941-3 hsa-mir-941-4 hsa-mir-941-5
• Sequence: cacccggcugugugcacaugugc
• Deep sequencing: 87795 reads, 144 experiments

References

1. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).
2. PMID:19784364 "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP PLoS One. 4:e7192(2009).