Mature sequence tae-miR1130a

Accession numberMIMAT0005365
IDtae-miR1130a
Previous IDstae-miR1130
Stem-Loop tae-MIR1130a
Sequence
ccuccgucucguaauguaagacg
Get sequence
Deep sequencing1275 reads, 116 experiments

References

1
PMID:17543110 "Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)" Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu JK, Sun Q Genome Biol. 8:R96(2007).